[Epub] ➟ Schismatrix Plus By Bruce Sterling – Saudionline.co.uk

Schismatrix Plus chapter 1 Schismatrix Plus, meaning Schismatrix Plus, genre Schismatrix Plus, book cover Schismatrix Plus, flies Schismatrix Plus, Schismatrix Plus 53343eb4c059f Schismatrix Plus, Is Bruce Sterling S New Trade Paperback For The First Time In One Volume Every Word Bruce Sterling Has Ever Written On The Shapers Mechanists UniverseIn The Last Decade, Sterling Has Emerged A Pioneer Of Crucial, Cutting Edge Science Fiction Now Ace Books Is Proud To Offer Sterling S Stunning World Of The Schismatrix Where Shaper Revolutionaries Struggle Against Aristocratic Mechanists For Ultimate Control Of Man S Destiny This Volume Includes The Classic Full Length Novel, Schismatrix, Plus Thousands Of Words Of Mind Bending Short Fiction


10 thoughts on “Schismatrix Plus

  1. says:

    What a great read this was I ve never been much of a fan of cyberpunk and I m not particularly a fan of the authors generally noted to be founders of the genre William Gibson, Neal Stephenson, etc , but I really loved this book and it has put Bruce Sterling near the top of my list for sci fi writers Sterling does an excellent job of melding his cyberpunk ethos with a space opera ish background that is combined with the Grand Tour of the solar system structure cp The Ophiuchi Hotline by John Varley or Vacuum Flowers by Michael Swanwick to create a really delectable sci fi romp Though perhaps romp isn t quite the right word _Schismatrix Plus_ is composed of the novel _Schismatrix_ along with all of the published short stories in the same Shaper Mechanist universe I wish there were The Shapers and Mechanists are the two major offshoots of humanity who have colonised the solar system in a slower than light speed cosmos The Shapers are a faction devoted to the improvement of the human form and mind through genetic engineering and are known for their somewhat aristocratic and elitist bearing, while the Mechanists are those who instead chose the path of merging the human form with machine technology in the quest for immortality and transcendance The Earth kicked both factions out at some point in the past and is now considered interdicted by both.In _Schismatrix_ itself we follow Abelard Lindsay, an aristocrat from one of the earliest space habitats orbiting the moon, who was sent to be trained as a Shaper diplomat in his youth and who is ultimately betrayed by his childhood friend and colleague Philip Constantine as they try to overthrow the gerontocracy of their republic not really a spoiler as this happens early in the book and is the main impetus for the plot Lindsay is sent into exile and thus begins his great tour of the solar system where he comes across many of the human factions and organizations vying for power The solar system that Sterling creates is a colourful one and is filled with interesting characters and groups, some aligned with one or the other of the Shapers and Mechanists, and some looking out only for themselves These include a prostitute banker who becomes an ecosystem in herself, a playwright Mechanist, a group of space pirates who are also their own nation state, and a clan of Shaper terraformers Throughout his adventures Lindsay is both shaped by, and shapes, the human ecumene around him, at first simply trying to survive and later working towards fulfilling his great dreams for a post human future for humanity Added into this heady mix is a first contact with aliens that throws off the detente of the Shaper Mechanist war The story really is a tour de force as we follow Lindsay s rising and falling fortunes and get a glimpse of wide swathes of the fascinating human solar system created by Sterling.Sterling s world is further fleshed out by the short stories included here Swarm a chilling tale of Shaper meddling in things best left alone, Spider Rose the tale of a Mechanist loner who gets than she bargains for when she trades with aliens, Cicada Queen the story of an innovative Shaper that ties in with some of the events of _Schismatrix_, Sunken Gardens a tale of competition and terraforming to achieve a new post human dream, and Twenty Evocations a somewhat experimental story detailing snapshots of the life of the Shaper Nikolai Leng.Alastair Reynolds has acknowledged his debt to Sterling in the creation of his own Revelation Space universe and I m a little surprised that there aren t sci fi writers mining the myriad of ideas that Sterling throws off with seeming effortlessness in these stories This really is a great ride and is highly recommended for lovers of sci fi.Also posted at Shelf Inflicted


  2. says:

    The moment I read in Galactic North that Alastair Reynolds acknowledged Schismatrix as a huge influence in developing his Revelation Space series, I knew I had to eventually track it down Four years later, eventually finally happened So let me first of all clarify the difference between Schismatrix and Schismatrix Plus The Plus edition has five short stories set in the Schismatrix universe along with the novel length title story These short stories were enjoyable especially Swarm which brought to mind Peter Watt s excellent Blindsight in its treatment of a bizarre alien hive intelligence perhaps even chilling than the Scramblers Overall, I enjoyed Schismatrix Plus, but I had some issues which dropped it from the four or five star book I initially thought I was reading First the positive this is such an ambitious and imaginative work that only manages to occasionally feel dated for its thirty year age The ideas in this book come flying at a furious pace as it chronicles the life of an ambitious aristocrat navigating his way through a solar system where post humanity has split into various factions vying for power There is no singular post humanity in Sterling s universe, there are several clades of humanity Imaginative, unforgettable, and even absurdly comical scenes are in abundance on this odyssey.The problem is that Schismatrix reads like a loose collection of short stories The nebulous plot consists of the protagonist trying to outsmart and play the factions against each other through a diverse setting of locations and times in the Solar System But here is the problem Schismatrix is like a trying to eat a dozen colorful donuts on your own at first a delightful enterprise but after a couple, your taste buds are worn out and it starts becoming a tad tiresome Schismatrix lacks substance and instead is only propelled by Sterling s vertiginous ideas There was simply no reason to care and no one to really care for in this long journey, which is why I have to give it no than three stars I still believe it s worth a look if you are not dissuaded by what it lacks, and are interested in a challenging and wild reading experience.


  3. says:

    A bizarre absurdist bourgeois epic set in the space kindgom of the posthuman con artists Features hyperbole and sharp dark humor.As scientific and technological advances shatter the limitations which define modern thought and sustain the existence of a single human community, rugged individualists and pretentious youths boldy reach for transcendance.But as it turns out, it s bourgeois property relations which end up transcending the material conditions that sustained them Commodity fetichism doesn t even begin to describe this Freed from all material and social limitations to imprint their mystical freedom on a boundless cosmic blackboard, people file patents and trade stocks Nobody is in a position to actually enforce these property claims but people organize their lives around them anyway And so genetically engineered super Ponzis enjoy unfettered power over people s lives and homes.Do not fear this book has a high irony content This Austrian economic cult seems to be a product of cosmic evolution Indeed, in Schismatrix s universe the only thing that seems to allow advanced cultures to exist for long is this sort of capitalist nonsense Cultures which are not obssessed by it find something better to do than existence, you see Therefore pointless interstellar markets exist Because futility is freedom.Or something.Sterling is so deadpan with this stuff I don t know what he was thinking I do hope it s some kind of satire.Nonsense and cool existential musings aside, this book is crammed with nice SF concepts and fun and or dirty details If you don t mind all those quaint data tapes, that is.But it s disjointed, uneven, aimless and as you might have guessed by now fundamentally implausible.Parts of the book are simply nuts It s also a difficult read at times and a couple of scenes are borderline incomprehensible.All that said, Schismatrix is not 100% silly Serious issues are alluded to and stimulating ideas are shared with the reader.This book is also noteworthy for beign influential among hardcore genre practictioners.Alastair Reynolds much reasonable new series as far as the first installment is concerned anyway owes much to it for instance.


  4. says:

    I had written Bruce Sterling off as a relic of the cyberpunk era, big mistake The wow factor is pretty big on this Mind mutating, WTF, idea per sentence science fiction with shades at time of Bester, Triptree jr Delaney, Barrington J Bailey who blurbs it William S Burroughs, and Ballard Dense, filled with absurd humor and grotesque surreal visions, as human future and form breaks and cascades into increasing odd shapes I feel a little buzzed after finishing this This and a couple of short stories have put Sterling on my favorites list This book also had a profound influence on the books of Charles Stross and Alastair Reynolds, the former taking the zany idea flinging and economic speculation and the latter the grim, fractured weirdness.


  5. says:

    Alastair Reynolds said, in one of his Revelation Space books, that Bruce Sterling Schismatrix had a huge influence on his works and recommends it as one of the best cyberpunk stories Of course it piqued my interest and now, after I read it, I have to say he was right at least about the influence part.It is obvious that Shaper Mechanist universe stands at the base of Conjoiners Demarchists one and that the somber atmosphere is the one encountered mostly in Chasm City But the similarities between the two end here World building is almost nonexistent in Schismatrix but present to some degree in his short stories which are set in the same universe Also, the action starts too sudden, without preparing the reader for such a turn of events and the strange inhabitants of an even stranger world I missed the gradual immersion of Reynolds style I guess being AR s fan didn t help much.In fact, the whole time I got the feeling that Bester s Deceivers got lost in Chasm City, lol They took my womb out, and they put in brain tissue Grafts from the pleasure center, darling I m wired to the ass and the spine and the throat, and it s better than being God When I m hot, I sweat perfume I m cleaner than a fresh needle, and nothing leaves my body that you can t drink like wine or eat like candy The Zaibatsu recognizes one civil right the right to death You may claim your right at any time, under any circumstances All you need do is request it Do you wish to claim your civil right No, thank you , Lindsay said politely But it s a great solace to know that the Zaibatsu government grants me this courtesy I will remember your kindness As for the short stories, Swarm and Spider Rose deserve 5 awesome stars And even if Sterling style doesn t exactly match my taste, I really enjoyed his sharp irony and subtle humor and I have to give him credit for the imagination Had I have read it before Revelation Space I would have been stunned by it After all, he s not being considered one of the cyberpunk s founders for nothing.


  6. says:

    Another goodreads reviewer wrote It is creative, but one of the characteristics of this book is that the author writes as if the story is happening in our present world, so he does not define words and key elements just as an author writing in the present wouldn t define terms they assume are collective knowledge They gave this book one star One star It s times like these I realize how crazy some people are The above technique is one of the marks of good science fiction, as opposed to the forced and schlocky shit people think of when they think of science fiction.Anyway, in protest of this confusing and misguided review, I m upping my rating to five I have only fond memories of Schismatrix Plus Cockroaches Space pirates Zero G martial arts Terrible bacterial infections Genetically engineered hookers I guess it was amazing.


  7. says:

    Skv l v c, jak rom n, tak zejm na pov dky ze sv ta Schismatrixu Je to vlastn p b h o konci lidstva, o jeho p em n ch, o mnoha cest ch, kter mi se vyd v Za ijete asy v le n i m rov , revoluce jak politick , tak technologick , mezihv zdn cesty, kontakty s mimozem any, smrt i nesmrtelnostMoc se mi to l bilo.Dv v ci m mrz je velk koda, e toho ze sv ta Schismatrixu pan Sterling nenapsal v c a tak to, e jsem tuhle kn ku neotev el d v.


  8. says:

    I enjoyed this Sterling s writing style hooked me int he first few pages I appreciate his literary feel, and his use of drama, and non typical sci fi aspects in his novel The story unfolds over the life of the main character It s a future world hooked into computer systems, genetic manipulations and hybrids, aliens, inter planetary issues, action, mystery, suspense Although I found the writing difficult to adapt to, I found this a great pleasure I like his characters They have depth to me He also describes in detail the workings of the technology, which makes it believable.


  9. says:

    somewhere at the bottom of a well Steve Steve, wake up Come on, Steve, we got work to do Steve Senhor, is that you shouting It s two in the morning I was sleeping Who died, where is burning Nonsense, Steve It s two in the midnight Come, we have work to do We re back in business, I have a review to write and you re staring in it I ll tell you the plan on the way, come, come Senhor, you re an asshole I know it, the Queen gave me a medal for it, that s why I m a sir next evening A May rabbit rabbit rabbit walks into a bar The shocked bartender asks My god, what happ Sim perguntas, Decim The reviewer deludes himself he s a Shaper artist Oh, come on, Steve Just play your part I should have left you on that Jalape o pirate ship Decim, come drink with us on the table I ve just read this book, Schismatrix Plus, got some notes from it and I want us to discuss it so I can make a review I had read it too, a long time ago, don t remember much from it, save for the cockroach tequilas I still make from time to time I ll have one of those, if I may Senhor is paying Alright, the general impression this book is a basket full of goodies the writer took a piss on then ejected into space Isn t this a bit harsh I know it has an experimental structure, but it was meant as a cyberpunk experiment This is no excuse for the characters he came up with It felt like I was in a shady oriental open bazaar Weird characters and entities popping up everywhere begging for your attention, promising you services you didn t even knew existed, behaving strangely one was walking on his nose hairs instead of his feet for in the end you discover you got pickpocketed, your trousers are on, but your underpants are gone I never was a fan of cyberpunk, it feels so artificial Fantasy feels real, I accept talking dragons, but ordinary people being familiar with basic principles of physics and chemistry That s fake all day They rather gargle water a beardy mad guy blessed to cure cancer, than actually seek medical care Scientists say all particles vibrate Does this mean vibrators are particle accelerators That s not how it works The closest particle accelerator you re going to use is your microwave oven You can make popcorn and fly in space with sublight speed in less than 2.5 minutes I told you that crate of second hand sex toys was a bad investment Read this book, genetically engineered prostitutes are the future Speaking of popcorn, I find it interesting how in these cyberpunk novels the human race is augmenting itself with drugs, hormones, prosthetics, jumps from one fashion to another, from an extreme to another, they are restless, eager to accede another state of mind, yet politically they behave the same for thousands of years Maybe it s politics that defines humanity Bad politics that is The book itself it s lacking a direction, a certain plan, a fluent story, some characters to love and others to hate I wish the main character wasn t so over sexualized, or maybe this is due to the drugs What drugs, the ones mentioned as aphrodisiacs are good only to dye your eggs Steve, don t dye your Easter eggs with aphrodisiacs, please You also have vasopressin which is % and _ At some point I found TCGAGGCTATCGTAGCTAAAGCTCTCCCGATCGATATCGTCTCGAGATCGATCGATGC TTAGCTAGCTAGTTGTCGA TCGTAGGGCTCGAGCTA And I was really excited to decode it hoping there was a secret message hidden in it There isn t, but then it is too short to even mean something else than a string So is your life Decim, I thought you got rid of that annoying talking goat It isn t a goat, it s an alien that calls himself the Swarm Makes perfect sense Then I m left with all these ideas that floats into a void which is the story, ideas that revolves around the fact that we are a primitive society and will always be because it s in our design and the fact that the threat of death is bigger for the happy ones Let s not forget about the obsession with bacteria, mold and microorganisms Speaking about molds, I d have another beer And a cockroach tequila for Steve In the end I just hope this book will serve as inspiration for writers such as Al Reynolds and expect nothing from it in terms of a story About the ideas I ve noted, we ll talk when you get back with the drinks.


  10. says:

    SCHISMATRIX PLUS is one of Bruce Sterling s early novels, long unavailable, and now back in print as an ebook The Plus indicates that the book also includes a bunch of short stories set in the same future world as the novel itself This novel has much of a far future setting than the bulk of Sterling s subsequent work It follows the adventures of the main character, Abelard Lindsay though at times he uses many other names from being a 20 something rebel to being the 200 years old or so due to life extension technologies guru of his own particular faction of posthumans The novel explores the posthuman condition or better, a multitude of posthuman conditions, as advancing technology leads human beings into many different possible reconfigurations, many of which do not sit well with one another In the course of the book, there is a kind of speciation of multiple, and incompatible, posthuman variants The main social development in the solar system of the novel filled with inhabited moons, planetoids, asteroids, and artificial habitats is the split between Shapers who retool the human genome for increased healthy, intelligence, and agility and Mechanists who retool their bodies with all sorts of mechanical and computational augmentations But in the course of the book, this basic duality or antagonism seems less and less important, as multiple new forms of posthumanity get constructed By the end of the novel, we are looking at radical genetic reconstruction to allow posthumans to live, breathe, eat, and reproduce in the oceans beneath the crust of Europa the Jovian moon What gives the book its power and tension is the harsh conflict between a sense of wonder at the majestic technological reinventions of humanity on the one hand, and a depressing view of ugly power politics which seem to be replayed endlessly regardless of technological means At one point, the narrator notes, of the expansion of human beings into other parts of the solar system It was a complex and depressing history, littered with betrayals, small scale rivalries, and pointless power games In Sterling s vision, however much we change ourselves, we never really get away from this sort of recurring and stupid conflict But Sterling also suggests that it may well be this sort of depressing history that spurs potentially liberatory inventions Throughout the novel, Abelard Lindsay is never contented He is perpetually restless, or even perpetually in a rage, over the limitations of society and indeed of embodied experience And so he continually moves from one sort of technological and social living arrangement to another the continual process of discovery and innovation itself seems to be the point for him, rather than its necessarily limited results I am inclined to think that this is all too accurate a portrayal of how desire and innovation work under capitalism though the aesthete in me insists that another world is possible Sterling doesn t himself envision such another world, but his novel convincingly shows that no degree of technological self transformation can in and of itself change the gloomy parameters of this one.


Add a Comment

Your email address will not be published. Required fields are marked *